|
| |
 |
|
| ABSTRACTS |
|
| Year : 2019 | Volume
: 2
| Issue : 1 | Page : 32-35 |
|
Abstracts of Award Papers, MDSICON 2019, New Delhi
| Date of Web Publication | 17-Apr-2019 |
Correspondence Address:
 Source of Support: None, Conflict of Interest: None
DOI: 10.4103/AOMD.AOMD_00_00
How to cite this article:
. Abstracts of Award Papers, MDSICON 2019, New Delhi. Ann Mov Disord 2019;2:32-5 |
| ABSTRACT-1 | |  |
Volumetric abnormalities of hippocampal subfields in Essential Tremor
Shweta Prasad1, Apurva Shah2,3, Ketaki Swapnil Bhalsing1, Keshav J Kumar1, Jitender Saini1, Madhura Ingalhalikar1,3, Pramod Kumar Pal1
1National Institute of Mental Health & Neurosciences, Hosur Road, Bangalore-560029, Karnataka, India, 2Symbiosis Center for Medical Image Analysis and 3Symbiosis Institute of Technology, Symbiosis International University, Lavale, Mulshi Pune-412115, Maharashtra, India
Introduction: Multi-domain cognitive impairment (CI) has been frequently described in patients with essential tremor (ET). However, the exact neuroanatomical basis for this impairment is uncertain. This study aims to ascertain the role of the hippocampal formation in cognitive impairment in ET.
Methods: Forty patients with ET and 40 age, gender and education matched healthy controls (HC) were enrolled. Cognition was assessed using a structured neuropsychological battery and patients were categorized as ET with CI (ETCI) and ET without CI (ETNCI). Automatic segmentation of hippocampal subfields was performed using FreeSurfer 6.0. The obtained volumes were correlated with scores of neuropsychological tests.
Results: Significant atrophy of the left subiculum, CA4, granule-cell layer of dentate gyrus, right molecular layer, and hypertrophy of bilateral para-subiculum, right hippocampus-amygdala- transition-area, hippocampal fissure (HF), and bilateral hippocampal tail (HT) was observed in ET. Trends toward atrophy of right subiculum, and hypertrophy of left HF was also observed. Comparison of HC and ETCI revealed atrophy of right subiculum, and hypertrophy of bilateral para-subiculum, HT, and left HF. ETCI showed a trend toward hypertrophy of right HF. ETNCI had isolated left para-subiculum hypertrophy and in comparison, to ETNCI the ETCI subgroup had atrophy of bilateral fimbria. Significant correlations were observed between the volumes of HT, HF, fimbria and scores of tests for executive function, working and verbal memory.
Conclusion: Patients with ET have significant volumetric abnormalities of several hippocampal subfields and these abnormalities may form the core neuroanatomical basis for the cognitive impairment observed in essential tremor.
| ABSTRACT-2 | | |
Intracortical facilitation is lost in patients with progressive supranuclear palsy – cortico-basal syndrome (PSP-CBS): A transcranial magnetic stimulation (TMS) study
Amitabh Bhattacharya, Albert Stezin, Nitish Kamble, Ravi Yadav, Pramod Kumar Pal
Department of Neurology, NIMHANS, Bangalore
Introduction: Progressive supranuclear palsy – cortico-basal syndrome (PSP-CBS) is a subtype of PSP, which is a progressive atypical parkinsonian disorder due to deposition of abnormal tau protein. We aimed to study the cortical excitability changes in both the hemispheres of these patients using transcranial magnetic stimulation (TMS).
Methods: The study was conducted in department of Neurology, NIMHANS, Bangalore. Eight patients of PSP-CBS were enrolled in the study. Informed consent was obtained from the patients. Patients underwent bilateral TMS using single and paired pulse TMS. The parameters that were recorded include: resting motor threshold (RMT), central motor conduction time (CMCT), contralateral and ipsilateral silent period (cSP, iSP), short interval intracortical inhibition (SICI) and intracortical facilitation (ICF).
Results: The mean age of patients was 63.75±7.33 with an age at onset being 60.75±6.85. The duration of illness was 2.88±1.62 years. The RMT of the affected hemisphere was 55.50±23.55% and unaffected hemisphere was 46.00±16.09% and the difference was statistically significant (p < 0.05). In the affected hemisphere, the CMCT was 6.64±2.18 msec, cSP was 98.51±37.24 msec, iSP was 21.62±28.51 msec and SICI was 0.30±0.43 whereas in the unaffected hemisphere the CMCT was 5.33±1.21 msec, cSP was 88.09±50.81 msec, iSP was 31.10±43.80 msec and SICI was 0.69±0.74. ICF was not seen in both the hemispheres (0.32±0.62 for the affected hemisphere and 0.14±0.24 for the unaffected hemisphere). There was no significant difference observed for these parameters between the affected and unaffected hemispheres.
Conclusion: Patients with PSP-CBS have loss of intracortical facilitation that may suggest glutaminergic deficiency leading to the constellation of symptoms observed in these patients.
| ABSTRACT-3 | | |
Disease-in-a-dish: Drug discovery using patient derived stem cell
Gautam Wali
The University of Sydney
Introduction: Hereditary spastic paraplegia is a neurological disorder characterised by axonal degeneration of the corticospinal tract leading to lower limb spasticity. Mutations in the gene SPAST are the major cause of HSP. SPAST encodes Spastin, a protein involved in regulating microtubule dynamics.
Methods: To understand the underlying disease mechanism and identify potential drug treatments, we used two sources of patient-derived stem cell models: a) adult stem cells: olfactory neurosphere derived (ONS) cells, a population of neural progenitor cells, derived from biopsies of the olfactory mucosa of patients and b) induced pluripotent stem (iPS) cell derived cortical neurons.
Results: Patient cells have reduced Spastin, reduced stabilised microtubules, altered cellular distribution of cellular organelles mitochondria and peroxisomes and impaired peroxisome transport. When stabilised microtubule levels were restored in the patient cells using tubulin-binding drugs the peroxisome transport was also restored to control levels. Patient ONS cells were under oxidative stress and more sensitive to oxidative stress induced by hydrogen peroxide. These were restored to control levels by low doses of tubulin-binding drugs. To test if our findings in the patient ONS cells are relevant in patient cortical neurons those are degenerated in HSP patients, we reprogrammed SPAST patient skin fibroblast cells to iPS cells and differentiated the iPS cells to cortical neurons. Patient derived iPS cell-neurons showed amplified disease specific deficits previously observed in patient ONS cells. The tubulin binding drugs rescued the disease-specific defects in SPAST iPSC-neurons.
Conclusion: Based on our findings in patient-derived stem cell models, we suggest a mechanism whereby SPAST mutations lead to reduced levels of stable microtubules which compromises axonal transport and leads to increased oxidative stress. These disease-specific defects can be restored by treatment with tubulin-binding drugs. Our research establishes the use of multiple sources of patient-derived cells for disease modelling and drug discovery for HSP.
| ABSTRACT-4 | | |
Wider stance base: An important clinical marker in differentiating PSP and IPD
Koustav Chatterjee, Supriyo Choudhury, Banashree Mondal, Saptak Halder, Ravi Singh, Hrishikesh Kumar
Institute of Neurosciences Kolkata
Introduction: Progressive supranuclear palsy (PSP) is an atypical form of Parkinsonism More Details with gait difficulty, postural imbalance and gaze palsy. It is often misdiagnosed as PD in its early stage of evolution. Therefore, a clinical marker specific for PSP could reduce the ambiguity in diagnosis. Human bipedal gait can be objectively assessed by various spatial and temporal gait characters. In this cross-sectional study we examined the gait in PSP and PD patients to identify the unique gait feature of PSP patients.
Methods: The patients of PSP and PD were included in the study as per standard diagnostic criteria. The severity of motor impairment was assessed by MDS-UPDRS scale and the gait was compared in matched sample of PD and PSP based on motor severity. The gait parameters were objectively estimated through electronic walk-way (GaitRite).
Results: We included 70 PD and 43 PSP patients. The PSP patients were divided into four groups based on four quartiles of MDS-UPDRS part III score. In the first quartile the PSP and PD gait velocity were 60.25cm/sec and 69.89cm/sec respectively (p = 0.318). All other gait parameters were also comparable in them. The second quartiles demonstrated a significant difference in gait stance-width between groups (PSP 13.00 vs PD 9.61, p 0.04). Rest of the parameters did not show significant difference.
Conclusion: The PSP and PD with equivalent motor impairment, is difficult to differentiate in its early stage only by evaluating two-dimensional gait parameters. However, the PSP cases of comparable severity walk with a wider stance-width compared to PD patients upon motor progression.
| ABSTRACT-5 | | |
Differential expression of micro-RNA in SCA2 patients and its association with other neurodegenerative disease
Rakesh Kumar Singh1, Vishnu Swarup1, Mohammed Faruq2, Achal Kumar Srivastava1
1Neuroscience Centre, All India Institute of Medical Sciences, New Delhi, India, 2CSIR-Institute of Genomics and Integrative Biology, New Delhi, India
Introduction: Spinocerebellar ataxia type-2 (SCA-2) is an autosomal dominant form of hereditary ataxia which is commonest in India. It has a rapidly progressive course. Our objective was to identify targetable micro-RNA from SCA2 patient’s Peripheral Blood Mononuclear Cells and to do target prediction of identified micro-RNA and check its association with other neurodegenerative diseases.
Methods: Total RNA of genetically confirmed SCA2 patients (n = 7) and matched healthy controls (n = 7) were isolated from PBMCs and analysed for differential miRNA expressions through small RNA sequencing using Illumina HiSeq 2500. The uncontaminated reads were used for known and novel miRNA analysis using mirDeep2 tool. The target genes predicted for these known (miRWalk2.0) and novel miRNAs (miRanda). Differential expression analysis was performed using DESeq2.
Results: Out of 1,375 micro-RNA identified in combination for 14 samples, we found 2 up-regulated (hsa-mir-222, hsa-mir-1273a) and 3 down-regulated micro-RNA (hsa-mir-451, hsa-mir-4521, hsa-mir-144) at ≥2 fold change significant expression level (p < 0.05) in control vs SCA2 patients on that expression level.
Discussion: Altered hsa-miR-451 targets on same ATXN2 gene of SCA2 and reported cases ofALS. Other hsa-miR-4521, hsa-miR-144 and hsa-miR-222 were found to be associated with reported cases of Focal Cortical Dysplasia, Parkinson’s disease andAlzheimer’s Disease. The short RNA fragment 5’GGGCGACAAAGCAAGACUCUUUCUU3’(previously annotated as hsa-miR-1273a) was found to be exclusively up-regulated in SCA2 patients because it targets many genes involved in this pathway, like - TBCCD1, SLC35A3, PTBP1, TMEM33, C3, NRXN3, NF2, SGTB, NUPL2, SMG1, GUF1 and not yet reported in any movement disorders.
Conclusion: So these significantly altered micro-RNA/small-RNA might be used as biomarker or therapeutic target for SCA2 in future. We plan to validate this in large number of sample size. Some miRNAs may be implicated in many diseases.
| ABSTRACT-6 | | |
Glia play an important role in aging and susceptibility to MPTP: Cues for ethnicity-based differences in prevalence of Parkinson’s disease
Abhilash PL, Upasna Bharti, BK Chandrasekhar Sagar, Mariamma Philip, Phalguni Anand Alladi
National Institute of Mental Health and NeuroSciences, Bangalore, India
Introduction: Inflammaging a common phenomenon characterized by sub-threshold gliosis and low-grade inflammation during aging, if localized to substantia nigra pars compacta (SNpc), may trigger the onset of Parkinson’s disease (PD). An interesting aspect about PD is that, its prevalence shows geographic and ethnic variation. It is high among Caucasians than Africans or Asians. Similarly different mice strains show differential susceptibility to the neurotoxin MPTP, C57BL/6J mice is most sensitive while CD-1 mice appear resistant. A comparison of inflammaging and glial responses to MPTP in these strains may extend the understanding of PD pathogenesis.
Methods: We performed immunohistochemistry and unbiased stereology-based quantification of S100β-immunostained astrocytes and iba-1 stained microglia in SNpc of C57BL/6J and CD-1 mice (males; 15-17wk, 10 and 18 months; n = 6/ group). Unperfused brains at similar ages were rapidly sonicated with lysis buffer, centrifuged and processed for ELISA of pro- and anti-inflammatory cytokines (1,4 and 7 days post-MPTP; n = 6/group). For ultrastructural studies, mice (n = 3) were perfused with glutaraldehyde, ultrathin sections were stained with uranyl acetate and lead citrate. Hemoxygenase and Fractalkine expression was studied using Western blotting. All observations were made on control and MPTP-injected mice nigra/striatum.
Results: Both mice strains showed distinctive responses. Basal levels of proinflammatory cytokines TNF-α and IL-1β (but not IL-6) were higher in C57BL/6J whereas levels of anti-inflammatory TGF-β (not IL-4 or IL-10) were low. The proinflammatory cytokines remained upregulated till 7 days following MPTP-administration in C57BL/6J mice nigra whereas the compensation by anti-inflammatory cytokines was persistently low. Ultrastructural observations confirmed MPTP-induced astroglial transformation to a reactive phenotype and interestingly the cell organelles were preserved.
Conclusion: Aging modulates nigral inflammation and different mice strains respond in a differing manner. Identical mechanisms are likely in humans, which may partly explain the differential vulnerability of populations/individuals to PD.
| ABSTRACT-7 | | |
Robotic-assisted gait training in Parkinson’s disease rehabilitation: A pilot study
Ramakant Yadav, Aafreen, Sarvesh Agarwal
UP University of Medical Sciences (UPUMS) Saifai, Etawah, India
Introduction: Mobility and balance limitations are the most significant effects of Parkinson’s disease. The aim of this study was to evaluate whether a rehabilitation program by robot-assisted gait training (RAGT) is effectivein improving walking, balance and quality oflife (QOL) in patients with Parkinson’s disease.
Methods: A total of twenty five patients of idiopathic Parkinson’s disease in Hoehn and Yahr (H&Y) stage 2-4 were assigned to 45 minute treatment sessions 3 days a week, for three consecutive months of robotic assisted gait training (RAGT).Participants were evaluated before (T0)and after three months (T1)of invention. Outcomemeasureswere gait assessment by Time Up and Go Test (TUG), balance by Berg Balance Scale (BBS) and Quality of Life by Unified Parkinson’s Disease Rating Scale (UPDRS).
Results: Twenty-four patients (20 males and 4 females) completed the study with mean age 62.06±4.75 years and body mass index (BMI) 24.25±1.64. The mean severity of illness in Hoehn and Yahr stage 2.84±0.39 and duration of illness was 4.59±1.58 years. A statistically significant improvement was found in the walking with 95% Confidence Interval (CI) after completion of intervention in the Time Up and Go test (CI 1.08 – 1.68; p = 0.001), Berg Balance Scale (CI 0.68 – 1.56; p = 0.001) and Unified Parkinson’s Disease Rating Scale (CI 2.03 – 3.38; p = 0.001). Minor adverse events like dizziness, fatigue and muscle cramps were reported in some patients.
Conclusion: This pilot study suggests that robotic assisted gait training (RAGT) may improve walking ability, balance and quality of life in patients with Parkinson’s disease.
| ABSTRACT-8 | | |
Subtype categorisation of progressive supranuclear palsy based on the movement disorder society criteria and prognosis of progressive supranuclear palsy subtypes: A retrospective hospital-based cohort study
Rohan R Mahale, Syam K Krishnan, Divya KP,Asha Kishore
Comprehensive Care Centre For Movement Disorders, Department of Neurology, Sree Chitra Tirunal Institute of Medical Sciences and Technology (SCTIMST), Trivandrum-695011, Kerala, India
Introduction: Progressive Supranuclear Palsy is rare neurological disorder characterized by usually symmetrical parkinsonism, supranuclear gaze palsy, axial rigidity, gait disturbances, postural instability with early falls, and fronto-limbic cognitive dysfunction. The most widely utilised criteria are the NINDS-SPSP criteria (1996). In 2017, a new criterion has been developed by Movement Disorder Society (2017) enabling the diagnosis of various PSP subtypes which has been lately identified. The purpose of present study was to categorise patients of PSP into PSP subtypes based on the recently proposed Movement Disorder Society criteria and to study the clinical characteristics of the disease and prognosis in each of the PSP subtypes.
Methods: The study is a retrospective cohort based longitudinal evaluation of hospital case records carried out in Comprehensive Care Centre for Movement Disorders, Department of Neurology at Sree Chitra Tirunal Institute of Medical sciences and Technology. Hospital case records (out-patient clinic, movement disorders clinic and In-patient register) of patients was searched to identify cases in which PSP, PSP subtypes (PSP-P, PSP-CBS, PSP-PNFA, PSP-PAGF, PSP-F/bvFTD, PSP-C, PSP-OM, PSP-PI), evolving PSP was considered as a diagnostic possibility, by using a text word and diagnostic code search criteria from the year 1996 to 2017 and screened for eligibility for the study. Prognosis was assessed based on attainment and time to attain from disease onset of the five clinical disability milestones (inability to walk unassisted necessitating wheel chair or full time attendant, unintelligible speech, dysphagia or offering of percutaneous endoscopic gastrostomy, dementia and use of urinary catheters).
Results: A total of 334 patients were diagnosed as PSP and its subtypes during the study period and were available for assessment. Out of 334 cases of PSP, PSP-RS constituted the majority among the different subtypes (n = 241; 71.7%), the next common subtype was PSP-P (n = 45; 13.4%). Other subtypes included were PSP-CBS (n = 17; 5.1%), PSP-F (n = 14; 4.2%), PSP-PGF (n = 14; 4.2%), PSP-PI (n = 2; 0.6%) and PSP-SL (n = 1; 0.3%). No cases were diagnosed as PSP-OM. Wheelchair dependency due to repeated falls was the most common first milestone reached in all PSP patients (n = 292; 87.4%). Among the 5 clinical milestones, the mean duration of attainment of wheelchair dependency was earlier (Mean: 4.4±2.2) years (range: 1-23). Kaplan-Meier survival curves showed that PSP-P cases had significantly longer time interval in years from disease onset to wheelchair dependency, attainment of unintelligible speech, and attainment of severe dysphagia needing PEG as compared to other subtypes.
Conclusions:
1. The predominant subtype of PSP was the PSP-RS subtype constituting around 70% of total cases. Other subtypes were PSP-P, PSP-CBS, PSP-F, PSP-PGF, PSP-PI and PSP-SL that constituted the remaining 30% of patients.
2. PSP-RS patients had similar age at presentation, age at onset, duration of disease, number of milestones reached, duration from onset to reaching 5 clinical milestones were similar to PSP-CBS, PSP-F and PSP-PGF.
3. PSP-P patients had longer disease duration, duration of follow-up, tremor predominance, levodopa response, lesser number of milestones reached with more number of nil milestones reached, and longer duration to reach the milestones.
|
